RT-PCR for Gene Expression Analysis

RT-PCR was performed as previously described^{5 (link)}. For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1 h using AMV-RT (New England Biolabs), M-MLV RT (Promega) or Superscript III (Invitrogen). Strand-specific RT-PCR was performed using Superscript III RT (Invitrogen) or M-MLV RT (Promega). PCR was carried out using the resulting cDNA. For quantitative PCR (qPCR), SYBR Fast qPCR kit master mix (2×) universal (Kapa Biosystems, USA) was used with addition of ROX reference dye high and carried out on the Applied Biosystems 7900HT Fast Real-Time PCR system. Oligo sequences were reported previously^{5 (link)}. DIP1 Fw: 5′ TAATACGACTCACTATAGGGAGAAAGAAGTTGCGACAGAACCG 3′ and DIP1 Rv: 5′ TAATACGACTCACTATAGGGAGACGAACAGCTTGTAGATGGCA 3′. CamKII INE-1 Fw TGGGCTATTTTTAGGCGTCA, CamKII INE-1 Rv TATGAACGCGTCGATCTCAG, ey INE-1 Fw CGGAAAATGCCAAGGACTAA, ey INE-1 Rv GCTAAATGGGCACACTCGTC, INE-1 Fw GGCCATGTCCGTCTGTCC, INE-1 Rv AGCTAGTGTGAATGCGAACG, rox1 forward TGCAGTGGCAGTTTCTTCTG, rox1 reverse GGTCCGTGCAAAGCAGTAAT, rox2 forward TCTCCGAAGCAAAATCAAGC, rox2 reverse TGTTGCGTTCCAAGACACAT.