Generation of Reep6 Knockout Mice

sgRNA target site for murine REEP6 was selected using the CRISPR design tool (http://crispr.mit.edu/, AGAGTGGTCTTATGACGCGATGG). As previously described (19 (link)), Reep6 sgRNA was cloned into pDR274 to generate a T7 promoter-mediated sgRNA expression vector. Linearization of the vector was achieved by BsaI digestion. sgRNA was produced using the linearized vector (Maxiscript T7 kit, Life Technologies) and purified with RNA Clean and Concentrator-25 (Zymo Research). Cas mRNA was made as previously described (19 (link)). For microinjections to generate Reep6 K0 mice, Cas mRNA (40 ng/ul) and sgRNA (20 ng/ul) were mixed and microinjected into C57BL/6 embryos at the single-cell stage. To genotype Reep6 KO mice, we used a genomic PCR assay using the following primers: Reep6_F: TCCTGTTCTGGTTCCCTTTCTA and Reep6 _M13R: CTGCTCAGGAAACAGCTATGACGGAAAAATAAATCCAGCATCCA.
All mice in this study were housed under 12-h light and 12-h dark cycles. All animal operations were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.