CRISPR Genome Editing in CD34+ HSPCs

Electroporation was performed using Lonza 4D Nucleofector (V4XP-3032 for 20 μl as the manufacturer’s instructions). CD34+ HSPCs were thawed 24 h before electroporation. For 20 μl Nucleocuvette Strips, the RNP complex was prepared by mixing 3xNLS-SpCas9 protein^{7 (link)} (100 pmol) or HiFi-3xNLS-SpCas9 protein (100 pmol) and sgRNA-1617: CTAACAGTTGCTTTTATCAC (300 pmol, IDT) with glycerol (2% of final concentration, Sigma, G2025) and P3 solution up to 10 μl and incubating for 15 min at room temperature immediately before electroporation. 50K HSPCs resuspended in 10 μl P3 solution were mixed with RNP and transferred to a cuvette for electroporation with program EO-100. The P3 solution was removed after 15 min of room temperature rest. The electroporated cells were resuspended with SCGM medium with cytokines and changed into EDM 24 h after electroporation.