CRISPR Genome Editing in CD34+ HSPCs
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : University of Verona, Dana-Farber Cancer Institute, Harvard Stem Cell Institute, Harvard University, Boston Children's Hospital, Center for Cancer Research, Massachusetts General Hospital, University of Massachusetts Chan Medical School, St. Jude Children's Research Hospital, Broad Institute
Variable analysis
- Electroporation method: Lonza 4D Nucleofector (V4XP-3032 for 20 μl)
- RNP complex composition: 3xNLS-SpCas9 protein (100 pmol) or HiFi-3xNLS-SpCas9 protein (100 pmol) and sgRNA-1617: CTAACAGTTGCTTTTATCAC (300 pmol)
- Electroporation outcomes (not explicitly mentioned)
- CD34+ HSPCs were thawed 24 h before electroporation
- RNP complex incubation time: 15 min at room temperature before electroporation
- Electroporation program: EO-100
- Cell culture conditions: SCGM medium with cytokines, changed to EDM 24 h after electroporation
- Positive control: Not specified
- Negative control: Not specified
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!