The analytical pipeline is illustrated using two biological replicates of each of the following four baits. RAF1 is a serine/threonine kinase that binds to Ras, several chaperones, and 14-3-3 proteins47 (link), 48 (link). EIF4A2 is a translation initiation factor that is part of the EIF4F complex, which bridges the mRNA cap structure to the ribosome via the EIF3 complex49 (link). WASL (also known as N-WASP) belongs to the Wiskott-Aldrich syndrome (WAS) family of proteins, involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton50 (link). Finally, MEPCE, the 7SK snRNA methylphosphate capping enzyme, interacts with numerous transcriptional and RNA processing proteins51 (link).
Cloning and expression of eIF4A2, RAF1 and MEPCE has been previously described15 (link). WASL and ORC2L were amplified by PCR from Mammalian Gene Collection constructs BC052955 and BC014834 respectively, and cloned into pcDNA5-FRT-FLAG (using EcoRI/NotI for WASL, and AscI/NotI for ORC2L), and the junctions sequenced. Primers used were: WASL_5′EcoRI, GATCGAATTCATGAGCTCCGTCCAGCAGC; WASL_3′NotI, GATCGCGGCCGCTCAGTCTTCCCACTCATCATCATC; ORC2L_5′AscI, GATCGGCGCGCCAATGAGTAAACCAGAATTAAAGGAAGAC; ORC2L_3′NotI, GATCGCGGCCGCTCAAGCCTCCTCTTCTTCC. The resulting vectors were stably co-transfected with the Flp-recombinase expressing vector pOG44 into Flp-In T-REx 293 cells (Invitrogen). Selection of stable transformants (single clones), clonal expansion, induction of protein expression and AP-MS were performed essentially as described in15 (link), using FLAG M2 agarose beads (Sigma). Two biological replicate analyses of each bait were performed, alongside six negative controls (cells expressing the tag alone). All samples were analyzed on an LTQ mass spectrometer coupled to an online C18 reversed phase column. The detailed protocol is #48 in the CRAPome. The mass spectrometry data was searched using the X! Tandem/TPP/ABACUS pipeline and settings as described inGlobal analysis and reduced gene counts . The filtered ABACUS file was formatted for CRAPome as described in Data formats using an in-house tool. Data were uploaded to the CRAPome (workflow 3). Two sets of additional controls (Set 1 and Set 2, see main text for detail) were selected and used alongside the user controls. SAINT and FC scores were generated using different settings (see main text and below). The ORC2L bait was processed in a similar way and uploaded for analysis to the CRAPome separately (it was not used for comparison between SAINT and FC scores shown in Fig. 3 ). The resulting input data matrices for eIF4A2, RAF1, MEPCE, and WASL baits and the six user controls, as well as for ORC2L and the same user controls, can be downloaded from the CRAPome website.
Cloning and expression of eIF4A2, RAF1 and MEPCE has been previously described15 (link). WASL and ORC2L were amplified by PCR from Mammalian Gene Collection constructs BC052955 and BC014834 respectively, and cloned into pcDNA5-FRT-FLAG (using EcoRI/NotI for WASL, and AscI/NotI for ORC2L), and the junctions sequenced. Primers used were: WASL_5′EcoRI, GATCGAATTCATGAGCTCCGTCCAGCAGC; WASL_3′NotI, GATCGCGGCCGCTCAGTCTTCCCACTCATCATCATC; ORC2L_5′AscI, GATCGGCGCGCCAATGAGTAAACCAGAATTAAAGGAAGAC; ORC2L_3′NotI, GATCGCGGCCGCTCAAGCCTCCTCTTCTTCC. The resulting vectors were stably co-transfected with the Flp-recombinase expressing vector pOG44 into Flp-In T-REx 293 cells (Invitrogen). Selection of stable transformants (single clones), clonal expansion, induction of protein expression and AP-MS were performed essentially as described in15 (link), using FLAG M2 agarose beads (Sigma). Two biological replicate analyses of each bait were performed, alongside six negative controls (cells expressing the tag alone). All samples were analyzed on an LTQ mass spectrometer coupled to an online C18 reversed phase column. The detailed protocol is #48 in the CRAPome. The mass spectrometry data was searched using the X! Tandem/TPP/ABACUS pipeline and settings as described in
