qPCR Analysis of Piezo2 in DRG Neurons

qPCR analysis was performed as previously described (14 (link)). Briefly, total RNA was extracted using TRIzol/chloroform and isopropanol precipitation from freshly isolated dorsal root ganglion neurons (Life Technologies). Generation of complementary DNA was achieved by reverse transcription using the QuantiTect Reverse Transcript kit (Qiagen). For qPCR, FastStart Universal probe master mix (Rox) from Roche Diagnostics was used. The reaction was run in the Eco RealTime PCR instrument (Illumina) using 0.5 μl of the cDNA in a 10 μl reaction according to the manufacturer’s instructions. Real-time Taqman qPCR assays were purchased from Integrated DNA Technologies with a FAM reporter dye and a non-fluorescent quencher: mouse Piezo2 (Mm.PT.56a.32860700), and an internally designed mouse Gapdh assay (forward primer: GCACCACCAACTGCTTAG; reverse primer: GGATGCAGGGATGATGTTC; and probe: CAGAAGACTGTGGATGGCCCCTC).

Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link: Access Free Full Text.

Murthy S.E., Loud M.C., Daou I., Marshall K.L., Schwaller F., Kühnemund J., Francisco A.G., Keenan W.T., Dubin A.E., Lewin G.R, & Patapoutian A. (2018). The mechanosensitive ion channel Piezo2 mediates sensitivity to mechanical pain in mice. Science translational medicine, 10(462), eaat9897.

Publication 2018

QuantiTect Reverse Transcript kit FastStart Universal probe master mix (Rox) Eco RealTime PCR instrument Real-time Taqman qPCR assays

Assay Cdna Chloroform Diagnostics Dorsal root ganglion Gapdh Isopropanol Mouse Neurons Primer Realtime pcr Reverse transcription Trizol

Corresponding Organization : Howard Hughes Medical Institute

Other organizations : Max Delbrück Center, Charité - Universitätsmedizin Berlin

Top 5 similar protocols

Variable analysis

independent variables

None explicitly mentioned

dependent variables

Expression levels of mouse Piezo2 and Gapdh

control variables

Total RNA extraction from freshly isolated dorsal root ganglion neurons
Reverse transcription using the QuantiTect Reverse Transcript kit (Qiagen)
QPCR using FastStart Universal probe master mix (Rox) from Roche Diagnostics
QPCR reaction run in the Eco RealTime PCR instrument (Illumina)

controls

Positive control: Internally designed mouse Gapdh assay
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!