Modulating ERα36 Expression in Breast Cancer

For stable ERα36 overexpression or knockdown, lentivirus-expressing ERα36 (GenBank Accession No. BX640939) or ERα36-specific shRNAs^{19 (link),25 (link)} were packaged by transfection of HEK293 cells. After 48 h, viruses were harvested and filtered through 0.45 μm filters. Viral titers were determined by using infected 3T3 cells. MOI 5 to 10 were used depending on individual cell lines. Lentivirus and 8 μg/mL polybrene (Invitrogen) were added to the culture of breast cancer cells and incubated overnight at 37 °C in a humidified atmosphere with 5% CO₂. Gene transduction efficiency was determined by FACS analysis GFP. To eliminate the off-target effects, two shRNAs were designed to target different 3′ UTR region of ERα36. The following shRNAs were used:
Scrambled shRNA: TTCTCCGAACGTGTCACGT
shERα36-1: GCAATTATTCCTTTGCCTTGC;
shERα36-2: GCGTTGCATCATAACATAAGC.
All lentivirus contained GFP-encoding sequences of the infected cells were verified by flow cytometry and immunobloting assays.