The PRESTO-Tango library (Addgene kit no. 1000000068) was a gift from Bryan Roth (University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA) (47 (link)). Plasmids encoding for human GPCRs were constructed by subcloning the ORFs from PRESTO-Tango to remove the C-terminus reporter sequence. pGloSensor-22F was purchased from Promega. The plasmid for knocking out human OXGR1 was constructed by ligation of sgRNA sequences into pLentiCRISPRv2 (sgOXGR1-1: CGTGGGATTTCCAGGCAATG; sgOXGR1-2: CTAGACTATTTAGCAAATGC). All other plasmids were purchased from Addgene. The siRNA target Gq/11 (siGNAQ: GACACCGAGAATATCCGCTTT; siGNA11: GCTCAAGATCCTCTACAAGTA) and β-arrestins (siARRB1/2: AAACCTGCGCCTTCCGCTATG siARRB1: AAAGCCTTCTGCGCGGAGAAT; siARRB2: AAGGACCGCAAAGTGTTTGTG) was synthesized by GenePharma. Oxgr1–/– mice were a gift of Gang Shu (South China Agricultural University, Guangzhou, China) (48 (link)). Irg1–/– mice (JAX, stock no. 029340) were purchased from The Jackson Laboratory. All mice were on a C57BL/6J background.
Free full text: Click here
