Quantification of ONNV Viral Genome

Ten microliters of blood were obtained from the tail vein, and re-suspended in 120 μl of PBS supplemented with 10 μl of citrate-phosphate-dextrose solution (Sigma-Aldrich). The viral RNA in the blood samples were purified by QIAamp Viral RNA kit (Qiagen), according to the manufacturer's protocol. Viral RNA is eluted in 60 μl of elution buffer. Viral load in 1 μl of the elution buffer was subsequently quantified by qRT-PCR using QuantiTect Probe RT PCR kit (Qiagen). For ONNV viral genome quantification, the following primers were designed to amplify negative nsP1 viral RNA: forward primer (AATTACGCGAGAAAACTTGCG), reverse primer (TTTTTCCAGAGATGTTTTTATCTGT) and TaqMan Probe (CCGCTGGAAAGGT), as described previously (14 (link)). The cycling conditions used are as follows: 1) 50°C for 30 min; 2) 95°C for 15 min; 3) 45 cycles of 94°C for 15 s and 55°C for 1 min. Data collection occurred during the 55°C extension step (15 (link)).