Planarian RNAi Using In Vitro-Transcribed dsRNA

dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG). Each template (16 μl) was mixed with 1.6 μl of 100 mM rNTPs (Promega); 0.6 μl of 1M dithiothreitol (DTT; Promega); 4 μl of T7 polymerase; and 24 μl of 5x Transcription optimized buffer (Promega). Reactions were incubated for 4 h at 37°C. RNA was purified by ethanol precipitation, and re-suspended in a final volume of 30 μl milliQ H₂O. Forward and reverse strands were combined and annealed by heating at 56°C followed by cooling to 37°C. Animals used for RNAi were starved at least one week prior to first feeding and animals were fed twice a week. The RNAi food mixture was prepared using 12 μl dsRNA for 30 μl planarian food (homogenized beef liver)[73 (link)]. For wntP-2; sp5 double RNAi experiments, every 1 part wntP-2 dsRNA was mixed with 2 parts sp5 dsRNA. Caenorhabditis elegans unc-22 was used as the control condition [74 (link)].