The CPSF3 gene was amplified using primers ‘ATGCTCCCTGCGGCAGCAGCAGTAA’ and ‘TTACACAGCCTCCTCTGGCAAAGGCT’, and integrated into the pTrex vector 47 (link) by NEBuilder HiFi DNA assembly (New England Biolabs). The construct of pTrex-CPSF was then transfected into Brazil tdTomato epimastigotes and selected by 60ug/ml blasticidin.
To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described 14 (link) and converted to cDNA using SuperScript Reverse Transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5'-TGAAACAGCAGCATGCCAAC-3' and 5'-CGCGTCTGTCTACCATCAGA-3') and CPSF-2 (5'-CGGCTCATTCTGATGGTAGACA-3' and 5'-TGTGCGTTGCACACTGAATG-3') in both control and CPSF over-expressing parasites, and the expression level was normalized to tubulin which was amplified using primers: ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described 14 (link) and converted to cDNA using SuperScript Reverse Transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5'-TGAAACAGCAGCATGCCAAC-3' and 5'-CGCGTCTGTCTACCATCAGA-3') and CPSF-2 (5'-CGGCTCATTCTGATGGTAGACA-3' and 5'-TGTGCGTTGCACACTGAATG-3') in both control and CPSF over-expressing parasites, and the expression level was normalized to tubulin which was amplified using primers: ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
