To confirm the CPSF overexpression in the selected transfectants, RNA was extracted as previously described 14 (link) and converted to cDNA using SuperScript Reverse Transcriptase (Invitrogen). Quantitative PCR reactions were performed in triplicate on the C1000 Touch Bio-Rad CFX96 real-time PCR detection system for CPSF using primer sets CPSF-1 (5'-TGAAACAGCAGCATGCCAAC-3' and 5'-CGCGTCTGTCTACCATCAGA-3') and CPSF-2 (5'-CGGCTCATTCTGATGGTAGACA-3' and 5'-TGTGCGTTGCACACTGAATG-3') in both control and CPSF over-expressing parasites, and the expression level was normalized to tubulin which was amplified using primers: ‘AAGTGCGGCATCAACTACCA’ and ‘ACCCTCCTCCATACCCTCA’.
CPSF Overexpression in Epimastigotes
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : University of Georgia, Texas A&M University, The University of Texas MD Anderson Cancer Center, University of Kansas, Pfizer (United States)
Variable analysis
- Overexpression of CPSF in Brazil tdTomato epimastigotes
- CPSF expression level, normalized to tubulin expression level
- Control (non-CPSF overexpressing) Brazil tdTomato epimastigotes
- Positive control: Tubulin expression in both control and CPSF overexpressing parasites
- Negative control: Not explicitly mentioned
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!