16S rRNA Amplicon Sequencing of Buffy Coat, Cecum, and Controls

For Illumina MiSeq Amplicon sequencing, 95 buffy coat, 48 cecum and 14 extraction control samples were processed. The variable region V3/V4 of the 16S rRNA gene was targeted using the published gene-specific sequences (Klindworth et al., 2013 (link)). Illumina adapter overhang nucleotide sequences were added to gene-specific sequences. The resulting full-length primer sequences used were 16S forward primer 5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTAC GGGNGGCWGCAG, reverse primer 5′ GTCTCGTGGGCT CGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTA ATCC. Library preparation including sample quantity control, NextEra two-step PCR amplification, equimolar pooling of samples and sequencing with a 250 bp paired-end read protocol (V3-V4) using an Illumina MiSeq sequencing platform were performed by the Next Generation Sequencing facility of the Vienna BioCenter Core Facilities,¹ Austria.