Quantifying MCPyV LT Gene Expression

Total RNA was extracted from the MCPyV positive specimens in order to study the expression of transcripts from the MCPyV LT gene. Total RNA was extracted with the Quick-RNA Miniprep Plus Kit (Zymo Research) and treated with DNase to avoid the amplification of viral DNA. The RNA was reverse-transcribed in cDNA with ZymoScript RT PreMix Kit (Zymo Research) including all the necessary components needed to perform robust reverse transcription. After the RNA sample is added to ZymoScript RT PreMix, the reaction is incubated for 2 min at 25 °C to initiate the reverse-transcription step. After the reverse-transcription step, the extension phase occurred at 25 °C for 10 min. After inactivation of the RT enzyme at 95 °C for 1 min, an aliquot of the reverse transcription reaction mixture (1 μL) was used for the subsequent PCR amplification carried out with primer sequences to determine the LT gene expression (LT-RNA-F sequence (5′→3′): GATCAGGAGGATTCAGCTTCG, nucleotide position based on MCC350 genome: 910–930; LT-RNA-R sequence (5′→3′): CAGAGGATGAGGTGGGTTCC, nucleotide position based on MCC350 genome: 1133–1152; predicted product size: 242 bp) [39 (link)]. The β-globin gene was amplified to confirm the presence of PCR-amplifiable cDNA.