Chemically Modified miRNAs for Intracellular Targeting

Example 1

miRNAs with naturally occurring sequences were fused covalently to phosphorothioated ssDNA (PS) 20meric oligo to facilitate cellular internalization targeting intracellular molecular targets. A non-phosphorothioated, phosphodiester ssDNA oligo (PO) extension of the miRNAs was employed as a non-internalizing control.

Applicants modified naturally occurring miRNAs, for example, let7a-3p (SEQ ID NO:1) (FIG. 1), let7a-5p (SEQ ID NO:2) (FIG. 3), miR17-3p (SEQ ID NO:3) (FIG. 5), miR17-5p (SEQ ID NO:4) (FIG. 7), and miR218-5p (SEQ ID NO:5) (FIG. 9) by attaching a phosphorothioated ssDNA (PS) 20meric oligo to the 3′ end of the miRNAs via a chemical linker. Examples of a phosphorothioated ssDNA (PS) 20meric oligo include, but are not limited to, SEQ ID NO:6 (TCCATGAGCTTCCTGATGCT) and SEQ ID NO:7 (AGCATCAGGAAGCTCATGGA). Applicants designed that the modification by ssDNA oligo avoids any C/G or G/C motifs, because it is known that CpG oligodeoxynucleotides (CpG-ODN) involve undesired Toll-like receptor (TLR) engagement and subsequent intracellular signaling. Applicants used an alkyl chain harboring a fluorophore as a linker to track the conjugate molecule.