For both research models, gene expression analysis of ESR1 and ESR2 was performed in a manner similar to the previous work [69 (link)]. In this paper, we briefly describe the research techniques used.
To perform qRT-PCR analysis, mRNA isolation was performed from the obtained material. The RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) was used for the tumor areas of the GBM tumor and the RNeasy Mini Kit (Qiagen, Hilden, Germany) for the cell culture material. The concentration and purity of the obtained isolate were checked using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). In a further step, the mRNA was transcribed into cDNA using Reverse Transcription PCR. qRT-PCR analysis was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and an ABI 7500 analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) (95° C (15 s), 40 cycles of 95 °C (15 s) and 60 °C (60 s)). The following primer sequences were used: ESR1: CCCACTCAACAGCGTGTCTC |CGTCGATTATCTGAATTTGGCCT, ESR2: AGATTCCCGGCTTTGTGGAG |GAGCAAAGATGAGCTTGCCG. The expression level of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as an endogenous control. The method was performed in the same way as described in the work by Simińska et al., where it is described in more detail [69 (link)].
To perform qRT-PCR analysis, mRNA isolation was performed from the obtained material. The RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) was used for the tumor areas of the GBM tumor and the RNeasy Mini Kit (Qiagen, Hilden, Germany) for the cell culture material. The concentration and purity of the obtained isolate were checked using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). In a further step, the mRNA was transcribed into cDNA using Reverse Transcription PCR. qRT-PCR analysis was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and an ABI 7500 analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) (95° C (15 s), 40 cycles of 95 °C (15 s) and 60 °C (60 s)). The following primer sequences were used: ESR1: CCCACTCAACAGCGTGTCTC |CGTCGATTATCTGAATTTGGCCT, ESR2: AGATTCCCGGCTTTGTGGAG |GAGCAAAGATGAGCTTGCCG. The expression level of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as an endogenous control. The method was performed in the same way as described in the work by Simińska et al., where it is described in more detail [69 (link)].
Free full text: Click here
