Quantitative FLT3 Mutation Profiling

PCR was performed on genomic DNA using an AccuPower HotStart PCR Premix (Bioneer, Daejeon, Korea) and specific primers [11 (link)] (forward: 5′-FAM- TGCCTATTCCTAACTGACTCATCA--3′, reverse:5′- TCTTTGTTGCTGTCCTTCCA − 3′) to amplify FLT3 exon 14 and 15 regions with following conditions: 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 60 s, and final extension at 72 °C for 7 min. Thereafter, 10 μL of the mixture of 0.5 μL fragment-length standard (GeneScan-600 LIZ Size Standard, Thermo Fisher Scientific, Foster City CA, USA) and 10 μL HiDi formamide (Thermo Fisher Scientific) was added to 1 μL of 30 times diluted PCR product. After the initial denaturation of this mixture at 95 °C, size-separation by capillary electrophoresis was performed on a 3130 Genetic Analyzer (Thermo Fisher Scientific) using the separation matrix POP-7 polymer (Thermo Fisher Scientific). Data analysis was performed using the GeneMapper version 3.2 software program (Thermo Fisher Scientific). The FLT3 ITD allelic ratio (AR) is calculated as the ratio of the peak height of the mutant product to the peak height of the wild-type product. The detection limit of PCR-based capillary electrophoresis fragment analysis used in this study was AR of 0.01. A manual review of the FLT3 ITD region was performed in all cases.