Allele-specific PCR for V1016G and F1534C Genotyping

Genotyping of the mutants V1016G and F1534C were performed according to previous publications [27 (link),34 (link)] for allele specific PCR assays. For the V1016G detection the PCR consisted of 1 μl of 10 pmol forward primer 5’ACCGACAAATTGTTTCCC3’, 0.5 μl of 10 pmol of each reverse primer 5’GCGGGCAGGGCGGCGGGGGCGGGGCCAGCAAGGCTAAGAAAAGGTTAACTC3’ and 5’GCGGGCAGCAAGGCTAAGAAAAGGTTAATTA3’, 12.5 μl of Dream Taq Green PCR Master Mix^® (Thermo Fisher Scientific) in a 25 μl total reaction volume. Reactions were performed as follows: 94°C at 2 min, 35 cycles of 30 s at 94°C, 30 s at 55°C, 30 s at 72°C, and a final elongation step for 2 min at 72°C. PCR amplification products were then loaded onto a 3% agarose gel. The F1534C detection PCR consisted of 1 μl of 10 pmol forward primer 5’GCGGGCTCTACTTTGTGTTCTTCATCATATT3’, 0.5 μl of 10 pmol of forward primer 5’GCGGGCAGGGCGGCGGGGGCGGGGCCTCTACTTTGTGTTCTTCATCATGTG3’ and 1 μl of reverse primer 5’TCTGCTCGTTGAAGTTGTCGAT3’, 12.5 μl of Dream Taq Green PCR Master Mix^® (Thermo Fisher Scientific) in a 25 μl total reaction volume. Reactions were performed as follows: 94°C at 2 min, 35 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, and a final elongation step for 2 min at 72°C. PCR amplification products were then loaded onto a 3% agarose gel as above mentioned.