MALAT1 Promoter gRNA Synthesis

Guide RNA (gRNA) sequences targeting MALAT1 promoter region were described before^{45 (link)}. Two guides, guide-1 (GCTGGGGCTCAGTTGCGTAA) and guide-2 sequence (AGGTTTCTAAAACATGACGG) were in vitro synthesized using the EnGen sgRNA Synthesis Kit, S. pyogenes (NEB# E3322S). The in vitro transcribed guides were purified using Monarch RNA cleanup Kit (NEB# T2040L). Manufacturer’s instructions were followed for both the above-mentioned kits. The MALAT1 gRNA were each eluted in 20 μl of nuclease free water and immediately aliquotted into PCR tubes and stored at −80 °C until use. The concentrations of purified gRNA were measured using NanoDrop 2000 (Thermo Fisher Scientific).