Total RNA was prepared as previously described (21 (link)). RNA concentration and purity was determined using a small volume spectrophotometer (Nanodrop, Thermo Scientific, USA). RNA was converted into cDNA using a commercial kit (SuperScript III for qRT-PCR, Invitrogen). All expression values were normalized to 36B4 expression using the ΔΔCt method. Primers for Rplp0 (36B4), Cfd, Cx3cl1, Il23a (p19), Il17a, and Ccl20 (MIP3α) have all been described previously (16 (link), 22 (link)). Primers for Il1α were forward – cggcaaagaaatcaagatgg and reverse ttcagagagagatggtcaatgg ; for Il1β forward – ctgtgtctttcccgtggacc and reverse – cagctcatatgggtccgaca ; and for IL-6 forward – ccggagaggagacttcacag and reverse – cagaattgccattgcacaac .
Free full text: Click here
