CRISPR-Cas9 Knockout Mice for DRG Studies

For CRISPR/gRNA studies, Cas9 knock-in mice from Jackson Laboratory (Strain# 024857) (Platt et al., 2014 (link)) were bred to mice expressing CRE recombinase under control of mouse beta-Actin promoter. From this breeding, E13.5 embryos were dissected and embryonic DRGs seeded and cultured as described above. For analysis of NMNAT2 protein levels after depletion of MKK4/7, DRGs were infected with lentivirus on DIV1. Cells were lysed on DIV 8 and cell extracts analyzed by western immunoblotting. For suppression of axon protection experiments, DRGs were infected with Bcl-XL and shRNAs on DIV 3 and gRNA to Nmnat2 or scrambled control on DIV 4. Axons were not fragmented spontaneously with gRNA to Nmnat2 during the course of the experiment. Scrambled gRNAs (CGTCGCCGGCGAATTGACGG and CGCGGCAGCCGGTAGCTATG), Map2k4 (MKK4) gRNAs (TTGTTTTACAGGGCGACTGT and TTTGTAAAACTTATCGAACG), Map2k7 (MKK7) gRNAs (TTGCAGCAAATGCGGCGCT and CCAAAGCACTGAACGATGTA), Nmnat2 gRNA (GGAGCCCACCTGTTTTCCGT). gRNAs were designed with help from the Genome Engineering and iPSC center. gRNA sequences were cloned into LentiGuide-puro plasmid (Addgene # 52963).