Multiplexed RAD-Seq Library Preparation

Ten RAD-Seq libraries were prepared for the 142 offspring and two parents following standard protocol [25 (link)]. Briefly, 1 µg of genomic DNA from each sample was digested with PstI restriction enzyme (Thermo Scientific, MA, USA) and incubated for 10 min in FastDigest buffer (total volume: 30 µL) at 65 °C. Barcode adapters (F: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA, R: AAGTCGGATCGTAGCCATGTCGTT CTGTGAGCCAAGGAGTTG) containing a sample-specific nucleotide code were designed following the standard Illumina adapters design protocol. A total of 10 µmol of unique barcode adapters from each DNA sample was added to the reaction system. Sixteen samples were pooled within each tube. Nine pools were collected, and fragments between 300 and 500 bp were selected. Finally, sequencing was conducted using the Illumina Hiseq 4000 platform (Illumina, CA, USA) with 150-bp paired-end strategy.