The pcDNA3-HA-p53 plasmid and pcDNA3 negative control empty vector were generously provided by Dr. Marin (Gonzalez-Cano et al., 2013 (link)). The pGPU6/GFP/Neo plasmid used for constructing the p53 short hairpin RNA (shRNA) vector was purchased from GenePharma (China). The p53 shRNA target sequence was TACCACCATCCACTACAACTA and the new plasmid was named Si-p53. A random DNA sequence (Si-control) was used as a negative control. Cells were seeded in six-well plates at 1 × 106/well and incubated overnight. pcDNA3-HA-p53, pcDNA3, Si-p53 and Si-control plasmids were transfected using TurboFect Transfection Reagent (Thermo Scientific) according to the manufacturer’s protocol. After incubation for 48 h at 37°C, cells were harvested and the expression of TAp73 and ΔNp73 was assessed by western blot analysis.
Protocol detail
Modulating p53 Expression in Cell Lines
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization : Southern Medical University
Other organizations : Nanjing Medical University, Nanjing University, Nanjing General Hospital of Nanjing Military Command
Top 5 similar protocols
Variable analysis
independent variables
- PcDNA3-HA-p53 plasmid
- PcDNA3 negative control empty vector
- P53 short hairpin RNA (shRNA) vector (Si-p53)
- Random DNA sequence (Si-control)
- Expression of TAp73 and ΔNp73
- Cell seeding density (1 × 10^6 cells/well)
- Incubation time (48 h at 37°C)
- Positive control: pcDNA3-HA-p53 plasmid
- Negative control: pcDNA3 negative control empty vector
- Negative control: Si-control (random DNA sequence)
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!