Evaluating NF-κB Responsiveness of HLA Promoters

To determine the NF-κB responsiveness of HLA promoters, we generated reporter constructs expressing firefly luciferase under the control of the HLA-B or HLA-C promoter. HLA-B and HLA-C promoter sequences were amplified from genomic DNA (gDNA) of mucous membrane cells obtained by buccal swabs (primer HLA-B/C_fw CCAGGAGGAGAAGTGAAGGGG]) and inserted into pGL3-enhancer (Promega) via KpnI/XhoI. A previously described NF-κB reporter vector served as a control (76 (link)). HEK293T cells were cotransfected with 0.2 μg of the firefly luciferase reporter construct and 0.1 μg of a Gaussia luciferase vector under the control of the pTAL promoter for normalization. All transfections were performed in 96-well plates, in triplicates, using the calcium phosphate method. NF-κB signaling was activated by the cotransfection of a constitutively active mutant of IκB kinase β (IKKβ) (0.8 μg). At 40 h posttransfection, a dual-luciferase assay was performed, and the firefly luciferase signals were normalized to the corresponding Gaussia luciferase control values.