Genetic Manipulation of ACOT1 in Mice

All mice were housed in a controlled temperature (20°C–22°C) and light (14-hour light/10-hour dark) vivarium during these studies. ACOT1 heterozygous KO mice were purchased from the NIH Knockout Mouse Project (VG12838), which uses VelociGene’s KOMP Allele Genotyping Strategies (Figure 1A). Next, heterozygous mice were bred together to generate mice with homozygous whole-body ACOT1KO. To confirm ACOT1 KO) via PCR, DNA was isolated from tail clips using DNeasy blood and tissue kit from QIAGEN and genotyped based on PCR protocols provided by the NIH Knockout Mouse Project using primers to identify the gene (TDF: AAGGATGAGACTATACCCCCTGTGA and SDR: ACTTCGGGAGGGAAGATGAG) and for the cassette (SUF: GTCAAAGACTGCCGGCTAAG and LacZRev: GTCTGTCCTAGCTTCCTCACTG), which indicates the absence of the ACOT1 gene (Figure 1B). Mice had free access to water and food, and at 8 weeks of age, ACOT1KO or littermate WT mice were switched to either a purified LFD (TD.94045) or a 45% HFD (TD.06415) from Harlan Teklad for 12 weeks. ACOT1 is highly active in most tissues during fasting (8 (link)); thus, mice in this study were fasted overnight for approximately 16 hours before sacrifice.