Kmt2df/f mice were previously described7 (link) and here we bred them with CD19-Cre mice (Jackson no. 006785) where Cre is expressed from the pre-B cell stage and removes exons 16–19 of Kmt2d causing an open reading frame shift that creates a stop codon in exon 20. Kmt2df/f CD19-Cre mice were maintained in a mixed C57BL/6; 129 background. Mice were monitored for tumor formation once a week for the first 4 months and every day after then. All mice were housed in the Frederick National Laboratory and treated with procedures approved by the NIH Animal Care and Use Committee.
The vavP-Bcl2 mouse model of FL9 (link) was adapted to the adoptive transfer approach using retrovirally transduced HPCs. HPCs isolation and transduction were performed as in30 . 8–10 week old C57BL/6 females lethally irradiated (4.5Gy twice) were used as recipients for all transplantation experiments. Mouse Kmt2d shRNAs were design usingD esigner of S mall I nterfering R NA (DSIR, http://biodev.extra.cea.fr/DSIR/ ) and are based on MSCV31
The vavP-Bcl2 mouse model of FL9 (link) was adapted to the adoptive transfer approach using retrovirally transduced HPCs. HPCs isolation and transduction were performed as in30 . 8–10 week old C57BL/6 females lethally irradiated (4.5Gy twice) were used as recipients for all transplantation experiments. Mouse Kmt2d shRNAs were design using
sh-Kmt2d #1 (mouse): GACTGGTCTAGCCGATGTAAA.
sh-Kmt2d #2 (mouse): TGAATCTTTATCTTCAGCAGG
