HeLaM cells (Tiwari et al., 1987 (link)) were seeded at a density of 106 cells per 9-cm dish. At least 2 h after seeding the cells, the first transfection was performed. For each 9-cm dish, 50 μl OligofectAMINE™ (Invitrogen) was added to 100 μl Opti-MEM® I (Life Technologies), and the solution was incubated at RT for 5–10 min. This was then added to a second solution or 800 μl Opti-MEM® I plus 50 μl 20 μM siRNA, and the mixture was incubated at RT for 15–20 min. Next, 4 ml Opti-MEM® I was added to the siRNA mixture to make a final volume of 5 ml, and this was added to the cells after rinsing them once with Opti-MEM® I. The transfection mixture was left for 4 h on the cells, after which 5 ml DME containing 20% FCS without antibiotics was added, and the cells were left in this mixture until they were trypsinized the following day. Two transfections were performed, on d 0 and d 2. The cells were trypsinized 24 h after each transfection and were seeded into two 9-cm dishes for the second transfection, whereas after the second transfection, they were plated onto coverslips or 35-mm dishes for uptake assays. For each experiment, an extra 35-mm dish was used to assay efficiency of knockdown.
Two independent siRNAs were used to investigate the effects of knockdown of each target. For AP-2, the targets were the α and μ2 subunits of the complex. The α-2 siRNA target sequence was AAGAGCAUGUGCACGCUGGCCA and the μ2-2 target sequence was AAGUGGAUGCCUUUCGGGUCA (other sequences, designated α-1 and μ2–1, were ineffective). The clathrin heavy chain target sequences were AAG-CUGGGAAAACUCUUCAGA (chc-1) and UAAUCCAAUUCGAAGACCAAU (chc-2). The control siRNA was a nonfunctional oligo, μ2–1, originally designed to knock down the μ2 subunit, target sequence AACACAGCAACCUCUACUUGG. All siRNAs were designed according to the manufacturer's instructions and were synthesized as Option C siRNAs by Dharmacon, Inc.