Quantifying ZIKV RNA from Cell Supernatant

RNA was extracted from 140 µl cell supernatant using the QIAamp viral RNA minikit (Qiagen, Valencia, CA) and eluted in 60 µl of buffer AVE (Qiagen) after on-column DNase treatment with RNase-free DNase (Qiagen). For quantifying ZIKV RNA, quantitative reverse transcriptase PCR (qRT-PCR) was performed on 2 µl of cell supernatant RNA extracted using ZIKV-specific primers (5′ TTGGTCATGATACTGCTGATTGC and 5′ CCYTCCACRAAGTCYCTATTGC) and probe (5′ 6-carboxyfluorescein [FAM]-CGGCATACAGYATCAGGTGCATWGGAG-minor groove binder nonfluorescent quencher [MGB-NFQ]) (Thermo Fisher Scientific, Waltham, MA) and the LightCycler 480 Master hydrolysis probe kit (Roche Applied Science, Indianapolis, IN) using the LightCycler 480 II real-time PCR system (Roche Applied Science). Sequences of the primers and probe targeting ZIKV have been modified from previously published sequences (18 (link)). Quantification of ZIKV RNA copies per milliliter of supernatant was performed against a standard curve of in vitro-transcribed MR766 ZIKV RNA.