Construction of Genetic Constructs for SecA

Strains and plasmids were constructed using standard methods (48 , 49 ). A list of all the strains and plasmids used in this study can be found in Table S1 in the supplemental material. An amber (TAG) codon was introduced at codon 796 of the secA gene in plasmids pDH625 (His-SUMO-SecA) and pDH545 (Strep-SUMO-SecA) using QuikChange (Invitrogen). Variants of secA under the control of an IPTG-inducible promoter were introduced onto the chromosome using λInCh (50 (link)). pDH733 was constructed by ligating annealed oligonucleotide SecMArrest-for (CATGGGAGACCGGTCCCGGGAGCTCTTCAGCACGCCCGTCTGGATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTT) and SecMArrest-rev (CCGGAAGGGCCAGCACGGATGCCTTGCGCCTGGCTTATCCAGACGGGCGTGCTGAAGAGCTCCCGGGACCGGTCTCC) and ligating them into plasmid pHK771 (51 (link)) cut with NcoI and BspEI. Derivatives of pDH733 were constructed by amplifying the fragment encoding the corresponding portion of SecM or MBP and ligating it into pDH733 cut with NcoI and SacI. Strep-SUMO-SecM-expressing plasmids were constructed by amplifying the SecM-encoding region from the corresponding pDH733 derivative and cloning it into pCA597 cut with BsaI and BamHI.