Total hippocampal RNA was isolated during the noted day and night time points, using methods described previously (Hansen et al. 2013 (link)). In brief, after RNA isolation, hippocampal cDNA was prepared using the miScript II Reverse Transcription kit (Qiagen). Amplification of cDNA was carried out using QuantiFast SYBR Green (Qiagen), and the miScript Primer System (Qiagen) was used to quantify miR-132 levels. The following miR-132 primer sequence was utilized: 5′ UAACAGUCUACAGCCAUGGUCG (Qiagen, Cat# MS00001561). QuantiFast SYBR Green thermocycling conditions were previously described by Alemayehu et al. (2013) (link). Data from both time points were normalized to RNU6B_2 cDNA levels, and Double Delta CT was used for analysis.
Protocol detail
Quantifying Hippocampal miR-132 Levels
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : The Ohio State University
Top 5 similar protocols
Protocol cited in 1 other protocol
Variable analysis
independent variables
- Time of day (day and night time points)
- MiR-132 levels
- RNU6B_2 cDNA levels (used for normalization)
- No positive or negative controls were explicitly mentioned in the protocol.
Annotations
Based on most similar protocols
Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.
Sign up for free or login to display all annotations
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!