Versatile CRISPR/Cas9 Vector Construction

Vector expressing both gRNA and mCherry (pCAGmCherry-gRNA) was generated as previously described^{30 (link)}. To construct gRNA expression vectors, each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA or gRNA_Cloning Vector (Addgene 41824). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study include: scramble, GCTTAGTTACGCGTGGACGAAGG; mutant GFP, CAGG GTAATCTCGAGAGCTTAGG; MH1, GCCGCTTTACTTAGGTCCCCGGG; and MH2, GGAGATCCACTCTCGAGCCCGGG; for PITCh donor: mouse Tubb3, AGCTGCGAGCAACTTCACTTGGG; human TUBB3, AGCTGCGAGCAGCTT CACTTGGG; human KCNQ1, AGTACGTGGGCCTCTGGGGGCGG; the downstream of CAG promoter in Ai14 mouse, TAGGAACTTCTTAGGGCCCGCGG; rat Mertk for HITI, GAGGACCACTGCAACGGGGCTGG; rat Mertk for HDR, TCAGGTGCTTAGGCATTTCGTGG. The Scramble-gRNA target sequence we designed is an artificial sequence that does not exist in human, mouse and rat genomes. We used the off-target finder software Cas-OFFinder (http://www.rgenome.net/cas-offinder/) to confirm that there were no genomic target sites within 2-bp mismatches. We have confirmed that the Scramble-gRNA can cut its target site in the donor vector (Extended Data Fig. 1b). pMDLg/pRRE, pRSV-Rev and pMD2.G (Addgene 12251, 12253 and 12259) were used for packaging lentiviruses. pEGIP*35 and tGFP (Addgene 26776 and 26864) were used for examining HDR and HITI efficiencies. To construct IRESmCherry-0c, IRESmCherry-1c, IRESmCherry-2c, IRESmCherry-MH, IRESmCherry-HDR-0c and IRESmCherry-HDR-2c, IRES and mCherry sequences were amplified with Cas9 target sequence by PCR from pEGIP*35 and pCAGmCherry-gRNA, respectively and co-integrated into pCR-bluntII vector (Invitrogen) with zero, one or two CAS9/gRNA target sequences. Cas9 expression plasmid (hCas9) was purchased from Addgene (41815). To generate different NLS-dCas9 constructs, pMSCV-LTR-dCas9-VP64-BFP (Addgene 46912) was used to amplify dCas9, which was subsequently subcloned into pCAG-containing plasmid with different NLS and 3 × Flag tag. To construct pCAG-Cas9 (no NLS), pCAG-1NLS-Cas9-1NLS and pCAG-1BPNLS-Cas9-1BPNLS, D10A and H840A mutations of dCas9 plasmids were exchanged to wild-type sequence by In-Fusion HD Cloning kit (Clontech). Then, pCAG-Cas9-2AGFP (no NLS), pCAG-1NLS-Cas9-1NLS-2AGFP and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP were constructed by adding 2AGFP downstream of Cas9. To construct pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS, 1BPNLS-Cas9-1BPNLS was amplified by PCR and exchanged with GFP of pCAG-floxSTOP-EGFP-N1 vector^{31 (link)}. To construct HITI donor plasmids for mouse and human Tubb3 gene (Tubb3-1c, Tubb3-2c, Tubb3-2cd, hTUBB3-1c and hTUBB3-2c) and PITCh donor (Tubb3-MH), GFP was subcloned into pCAG-floxSTOP plasmid with one or two CAS9/gRNA target sequences. To construct HDR donor for mouse Tubb3 gene (Tubb3-HR), GFP, 5′ and 3′ homology arms were amplified from pCAG-GFP-N1 or mouse genome, then subcloned into pCAG-floxSTOP plasmid. pCAG-ERT2-Cre-ERT2 was purchased from Addgene (13777). PX551 and PX552 were purchased from Addgene (60957 and 60958). To construct AAV-Cas9, nEF (hybrid EF1 α/HTLV) promoter (Invivogen) was exchanged with Mecp2 promoter of PX551. To construct donor/gRNA AAVs for HITI, donor DNA sandwiched by Cas9/gRNA target sequence, gRNA expression cassette and GFPKASH (or mCherryKASH) expression cassettes were subcloned between ITRs of PX552, and generated pAAV-mTubb3, pAAV-Ai14-HITI, pAAV-Ai14-luc, pAAV-Ai14-scramble and pAAV-rMertk-HITI. For pAAV-rMertk-HITI, exon 2 of rat Mertk gene including the surrounding intron is sandwiched by Cas9/gRNA target sequence, which is expected to integrate within intron 1 of Mertk by HITI. For HDR AAV (pAAV-Ai14-HDR and pAAV-rMertk-HDR), the homology arms were amplified by PCR from mouse and rat genome DNA, and subcloned into AAV backbone plasmid. The plasmids described in this manuscript will be available to academic researchers through Addgene.