IS1311 PCR-REA for Mycobacterium avium

The IS1311 PCR restriction endonuclease analysis (REA) was performed as described previously, to identify the strain type of MAP [20 (link), 24 (link)–26 (link)]. Briefly, the extracted DNA was added in an IS1311 PCR mix containing 1 μM of primers M-56 (5′-3′ GCGTGAGGCTCTGTGGTGAA) and M-119 (5′-3′ ATGACGACCGCTTGGGAGAC) and Taq Plus Master Mix II Dye Plus (Vazyme Biotech Co., Ltd., China). 8 μl of the positive IS1311 PCR solution was digested for 2 h at 37°C in a 16 μl reaction, which contained 2 U of each endonuclease HinfI and MseI supplemented with buffers provided by the manufacturer (Takara, Japan). And the products were analyzed by gel electrophoresis with 2% agarose gel and observed under UV light (Alpha RED, ProteinSimple).