Quantitative RT-PCR for IRE1a Gene Expression

RNAs extraction and RT-PCR assays were performed as previously [31 (link)]. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and the RNA was converted into cDNA using the PrimeScript™ RT reagent Kit (Takara Bio Inc, Shiga, Japan) via the first-strand synthesis system (Thermo Scientific, USA). RT-PCR was performed following the standard protocol on ABI 7500fast with SYBR Premix Ex Taq reagent kit (Takara Bio Inc, Shiga, Japan). The sequences of the RT-PCR primers were as follows: IRE1a sense: CACAGTGACGCTTCCTGAAAC, antisense: GCCATCATTAGGATCTGGGAGA; GAPDH sense:GGAGCGAGATCCCTCCAAAAT, antisense: GGCTGTTGTCATACTTCTCATGG.