Plasmid Extraction and CRISPR-Cas9 Targeting

Bacterial strains were cultured for 12–16 h in LB broth supplemented with ampicillin (30 µg/mL) and plasmids were extracted using a NucleoBond Xtra Midi Kit (Macherey-Nagel GmbH, Düren, Germany), according to the manufacturer’s instructions. The eluted DNA was precipitated with 70% isopropanol and reconstituted with TE buffer (Sigma-Aldrich, St. Louis, MO, USA). The plasmids were treated by either Cas9 (PNA Bio, Thousand Oaks, CA, USA) with tracrRNA (Dharmacon Inc., Lafayette, CO, USA) and crRNA (Dharmacon Inc., Lafayette, CO, USA), targeting specific antibiotic resistance genes (bla_CTX-M-14 or bla_CTX-M-15), or just the tracrRNA, without crRNA as control, as shown in the proof-of-concept experiments in Section 3.4. The sequences of the RNA targeting the bla_CTX-M-14 and bla_CTX-M-15 genes were 5′AGAGAGCCGCCGCGATGTGC3′ and 5′CCGTCGCGATGTATTAGCGT3′, respectively. After the Cas9 reaction, the plasmids were mixed with λ-DNA as internal size reference and then fluorescently stained with YOYO-1 and netropsin. The molar ratio of YOYO-1 to DNA was 1:2, while that of netropsin to YOYO-1 was 70:1; the staining was performed in 0.5x TBE buffer for 30 min at 50 °C. The samples were then diluted to 0.05x TBE to optimize the DNA stretching in the nanochannels [13 (link)]. Β-mercaptoethanol was added at 3% (v/v) to suppress photonicking and photobleaching.