Generation and Characterization of Sall1-Deficient Mice

Sall1^flox mice were produced as described20 (link)27 (link). Foxd1GFPCre (012463) and R26R-tdTomato (007905) mice were obtained from the Jackson Laboratory3 (link)29 (link). The primers used for genotyping were as follows: Cre1 (5′–AGGTTCGTTCACTCATGGA–3′) and Cre2 (5′–TCGACCAGTTTAGTTACCC–3′) for the Cre allele (250 bp); Sall1 flox2 (5′–CCTCTGCCCGAGAGATCG–3′), Sall1flox3 (5′–GGCGCGTCTGATTTTATTTC–3′) for the Sall1 allele (wild-type: 220 bp; mutant: 280 bp). Polymerase chain reaction (PCR) amplifications were performed using GoTaq DNA polymerase (Promega) by denaturation at 95 °C for 2.5 min, followed by 35 cycles of 95 °C for 30 s, 58 °C for 60 s, and 72 °C for 30 s, and a final extension at 72 °C for 7 min. All animal experiments were performed in accordance with the institutional guidelines and approved by the licencing committee of Kumamoto University (#A27-018).