Gastric Mucosa 16S rRNA Sequencing

DNA was enzymatically extracted from biopsies of gastric mucosa as previously described [18 (link)]. The V1–V2 region of the 16S rRNA was amplified using polymerase chain reaction (PCR) with the forward primer 27Fmod (5′- AATGATACGGCGACCACCGAGATCTACACxxxxxxxxACACTCTTTCCCTACACGACGCTCTTCCGATCTagrgtttgatymtggctcag-3′), containing the Illumina Nextera Adapters sequcence and a unique 8-bp barcode sequence for each sample (Barcode sequence by x), and the reverse primer 338 R (5′-CAAGCAGAAGACGGCATACGAGATxxxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtgctgcctcccgtaggagt-3′) containing the Illumina Nextera Adapters sequence using a 9700 PCR System (Life Technologies, Tokyo, Japan) as previously reported [19 (link)]. PCR amplicons were purified using AMPure XP magnetic purification beads (Beckman Coulter, Brea, CA, USA) and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (Life Technologies Japan). An equal amount of each PCR amplicon was mixed and subjected to sequencing with MiSeq (Illumina) using MiSeq Reagent Kit v2 (500 cycles) according to the manufacturer’s instructions [20 (link)].