HEK293T, TZM-bl, and CEM-SS cell lines were obtained from the American Type Culture Collection. HEK293T and TZM-bl cell lines were maintained in Dulbecco's modified Eagle's medium and CEM-SS cell line was maintained in RPMI 1640 medium (Corning Cellgro). Both media were supplemented to contain 10% fetal calf serum (Hyclone), 100 IU/ml penicillin and 100 μg/ml streptomycin (GIBCO).
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.
Free full text: Click here
