Human U2OS, HCT116, and 293T cells were cultured in DMEM supplemented with 10% fetal bovine serum at 37°C and 5% CO2. The FANCM-knockout HCT116 cells used in this study have been previously described (53 (link)).
MSH3-knockout (KO) in EGFP-HR-Flex reporter (U2OS) cells was generated using CRISPR–Cas9 technology. A gRNA sequence (TGAACAAACAGTCTGTGAGT) targeting the fifth exon of human MSH3 was sub-cloned into PX459 (Addgene#62988) for making MSH3-KO. Transfected cells with this plasmid were subjected to puromycin selection for 48 hours, followed by isolation of single clones. The MSH3-KO clones were confirmed by Western blot analysis.
MSH3-knockout (KO) in EGFP-HR-Flex reporter (U2OS) cells was generated using CRISPR–Cas9 technology. A gRNA sequence (TGAACAAACAGTCTGTGAGT) targeting the fifth exon of human MSH3 was sub-cloned into PX459 (Addgene#62988) for making MSH3-KO. Transfected cells with this plasmid were subjected to puromycin selection for 48 hours, followed by isolation of single clones. The MSH3-KO clones were confirmed by Western blot analysis.
