Quantitative Analysis of Circular RNA BTBD7

The protocols for RNA isolation and the qRT–PCR assay were specifically described in our previous publication [8 (link)]. Briefly, total RNA from PBMCs was extracted using 200 µl chloroform. It was then precipitated with an equal volume of isopropanol and washed with 1 ml of 75% ethanol. Then, after drying for 5 min, it was dissolved in RNase-free water. The quantity and quality of RNA were evaluated by means of a NanoDrop 2000 (NanoDrop Products, Wilmington, DE).
Using the primers listed in Table 1, a total of 500 ng of RNA was used as a template to prepare cDNA for PCR analysis. SYBR Green Real-time PCR Master Mix (Vazyme, Nanjing, China) in a StepOnePlus (Applied Biosystems) instrument was used to quantify the expression level of BTBD7_hsa_circ_0000563. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for internal normalization. The relative fold-change was calculated using the 2^−ΔΔCt method normalized to GAPDH. All experiments were performed in triplicate. Identification of BTBD7_hsa_circ_0000563 as a circRNA was conducted via Sanger sequencing following PCR.
Table 1

The oligonucleotide sequences of the primers for qRT–PCR

	Forward primer	Reverse primer
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA
BTBD7_hsa_circ_0000563	ATGCTTGCACAAGAAATGGA	GAACATGAATGAGGATAATTAG

GAPDH, glyceraldehyde-3-phosphate dehydrogenase