Engineered Canthaxanthin Biosynthesis Pathway

A DNA fragment containing genes for canthaxanthin biosynthesis was made by PCR amplification of 4 genes from Pantoea ananatis that are necessary for biosynthesis of β-carotene (genes crtE, crtY, crtI and crtB) [20] (link) and of one gene from Agrobacterium aurantiacum (crtW) necessary to convert β-carotene to canthaxanthin [21] (link). crtW is used in addition to the 4 Pantoea genes because the orange/red color of canthaxanthin is more visible on agar plates than the yellow color of β-carotene. The Pantoea ananatis strain was obtained from the DSMZ (cat. DSM 30080), and a fragment containing crtW was synthesized by Mr. Gene GmbH (Regensburg, Germany). An artificial operon containing crtE-W-Y-I-B under control of the P. ananatis native promoter was made by ligation of three fragments derived from PCR: fragment 1 containing the promoter and crtE was amplified from P. ananatis genomic DNA with primers 5′-ttt ggtctc a ggag ggtaccgcacggtctgccaa and 5′-ttt ggtctc a tcatgcagcatccttaactgacggcag, fragment 2 containing crtW was amplified from a synthetic DNA fragment (sequence identical to the native sequence) with primers 5′-ttt ggtctc a atgagcgcacatgccctgcc and 5′-ttt ggtctc a tcactcatgcggtgtcccccttggt, and fragment 3 containing crtY-I-B was amplified from P. ananatis DNA using primers 5′-ttt ggtctc a gtgacttaagtgggagcggctatg and 5′-ttt ggtctc a atgtagtcgctctttaacgatgag. The fragments were assembled by Golden Gate cloning in a target vector using BsaI. Two BpiI and one Esp3I site present in crtY were removed using primers containing silent mutations in the recognition sites.