Cell Line Validation and Experimental Reagents

Cell lines were purchased from Leibniz-Institut DSMZ—Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) and tested negative for mycoplasma. Low passage stock cell lines were tested for cell identity validation. Rapamycin (prepared in DMSO, final concentration 20 nM), MK-2206 (prepared in DMSO, final concentration 500 nM), BKM120 (prepared in DMSO, final concentration 5 µM), MDV-3100 (prepared in DMSO, final concentration 10 µM), I-BET762 (prepared in DMSO, final concentration 1 uM), and DHT (4,5α-Dihydrotestosterone, dissolved in ethanol, final concentration 10 nM) were purchased from LC laboratories (Rapamycin), ShelleckChem (BKM120, MK-2206), SCBT (MDV-3100), CAYMAN (I-BET762), and Sigma-Aldrich (DHT). Doxycycline was purchased from Sigma and used at 500 ng/mL for over-expression of YFP-PTEN.
shRNAs against GNMT (TRCN0000000326: sh1; TRCN0000000329: sh4) and FOXO1 (TRCN0000039582) were purchased from Sigma and control shRNA sequence is included (CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG). YFP-PTEN lentiviral constructs were described in [27 (link)].