PfCDPK1 and PfCDPK1 T145G proteins were produced using methods described elsewhere (23 (link)). The PfHSP90 N-terminal domain (NTD) comprises the first 223 amino acids of PfHSP90. This region was amplified from the full-length PfHSP90-pRSET-A construct (32 (link)) using the following primers: primer 7, GGCGACGGATCCATGTCAACGGAAACATTCGC; primer 8, GACCCCCTCGAGCTATTCTTCTTCAGATGCGG.
The PCR product was cloned into pRSET-A (Life Technologies) between the BamHI and XhoI sites. Positive clones were confirmed by restriction digestion and sequencing. The clone was transformed intoEscherichia coli Rosetta(pLysS) cells, and protein was expressed by induction with 0.1 mM isopropyl β-d -1-thiogalactopyranoside (IPTG) at 37°C for 2 h. PfHSP90 proteins were purified using Ni-nitrilotriacetic acid (NTA) affinity chromatography (Qiagen) as described in the manufacturer's protocol.
The PCR product was cloned into pRSET-A (Life Technologies) between the BamHI and XhoI sites. Positive clones were confirmed by restriction digestion and sequencing. The clone was transformed into
Free full text: Click here
