Genome Editing Protocol: CRISPR-Cas9 and T-DNA Integration

Genomic DNA was isolated from young leaves using the NucleoSpin Plant II kit (Machery-Nagel) according to the manufacturer’s instruction. The exon 4 of CiGAS-S1 and CiGAS-S2 containing the target site was amplified with specific primers (Supplementary Table 2) and overhang Illumina adapters to generate the Illumina library amplicons, which were sequenced on an Illumina MiSeq (PE300) platform (MiSeq ControlSoftware 2.0.5 and Real-Time Analysis Software 1.16.18) as reported by (Quail et al., 2012 (link)). The CRISPResso2 pipeline (https://crispresso.pinellolab.partners.org/submission; (Clement et al., 2019 (link))) was used to process the raw paired-end reads and to visualize the mutations profiles.
To detect T-DNA integration in the case of stable transformation, or plasmid integration in the case of transient plasmid delivery, a PCR was performed using genomic DNA as template (100 ng) and the primer pair Cas9wt for (CTTCAGAAAGGACTTCCAATTC) and Cas9wt rev (ATGATCAAGTCCTTCTTCACTT), using PCRBIO Taq Mix Red (PcrBiosystems) according to manufacturer’s instructions. A single specific amplicon of 693 bp was obtained in the case of positive signal.