The expression of Pgr, HoxA10, integrin β3 (Itgb3), and Lif mRNA in uterine tissues (one-third of one horn for 3-month-old mice and half horn for 1-month-old mice) was determined by real-time PCR. According to the manufacturer’s instructions, RNA from individual mice was isolated using an RNeasy® mini kit (Qiagen). For each sample, 1 µg of RNA was converted to cDNA using the FastGene Scriptase II Ready Mix (Nippon Genetics, Düren, Germany). The quantitative RT-PCR was performed using SYBR Green PCR Master Mix and specific primers (Table 2) in a Fast Real-time PCR (QuantStudio 3, Thermo Fisher Scientific). Relative gene expression was analyzed according to the 2−ΔΔCt method. All samples were assayed in duplicate reactions. The Rplp0 and Gapdh genes were used as housekeeping genes to normalize the expression level, as Lin et al. advised for mouse uterus (Lin et al. 2013 (link)).

Primers for RT-qPCR.

Gene nameGenBank numberPrimer sequences (5′–3′)Product size (bp)
ForwardReverse
PgrNM_008829.2CTACTCGCTGTGCCTTACCATGCTGGCTTTGACTCCTCAGTCCT139
Hoxa10NM_008263.4GGCAGTTCCAAAGGCGAAAATGTCTGGTGCTTCGTGTAAGGC86
Itgb3NM_016780.2GGCGTTGTTGTTGGAGAGTCCTTCAGGTTACATCGGGGTCA138
LifNM_008501.3GCTGTATCGGATGGTCGCATACACAGACGGCAAAGCACATT156
GapdhNM_001289726.2GGTGGACCTCATGGCCTACACTCTCTTGATCAGTGTCCTTGCT82
Rplp0NM_007475.5GGACCCGAGAAGACCTCCTTGCACATCACTCAGAATTTCAATGG85
Free full text: Click here