Isolation and Quantification of Human Retinal Cell Populations

Primary RPE/choroid and retina were dissected from an unfixed human eye. Retinal cell populations were separated using magnetic-activated cell sorting (MACS) as described in Grosche et al. (33 (link)). Human RPE for cultivation was isolated from healthy donor eyes (age 86 and 65 years) and treated as previously described (34 (link)). ARPE19 cells were purchased from ATCC (LGC Standard GmbH, Wesel, Germany) and cultivated as reported earlier (35 (link)). Human liver cDNA was kindly provided by V. M. Milenkovic (Department of Psychiatry and Psychotherapy, University Regensburg). mRNA of the cells was isolated (NucleoSpin RNA/Protein Kit, Macherey-Nagel, Düren, Germany), and cDNA was synthesized (Quantitect Reverse Transcription Kit, Qiagen, Hilden, Germany). qRT-PCR was performed using Quantitect primer sets (chfr3: QT00001631, cfh: QT00001624, gapdh: QT00079247) and Rotor Gene Sybr green PCR Kit (Qiagen, Hilden, Germany). Taqman PCR was performed using Brilliant III UF MM QPCR/Low ROX master mix (Agilent Technologies, Waldbronn, Germany) and the following cfhr3-specific primer (cfhr3-forward: gtttgcaaaatggatggtca; cfhr3-reverse: ggaggtggtatcaccattgc) and the FAM-labeled probe #25 (Roche Diagnostics, Mannheim, Germany).