CRISPR-Mediated Gene Editing Efficiency

Target sequences were amplified by PCR and SANGER sequenced (Macrogen), then purified by ISOLATE II PCR and Gel Kit (#BIO-52059; Bioline) or the Exo-Cip Rapid PCR Cleanup Kit (New England Biolabs). Gene editing efficiency was analyzed using TIDE analysis software (Brinkman et al, 2014 (link)). Each sample was corrected for background by subtracting the editing percentage in cells containing the control gRNA. PCR primers used are as follows: sgCAND1 #1 forward: GATTCCCGGAGTCAGTTTGG, sgCAND1 #1 reverse: CTGAAATCCAAAAGGCCGCT, sgCAND1 #2 forward: ATGCACTGGCATTTCCACAA, sgCAND1 #2 reverse: CCTAGCCAAGAGAAAACAAGTGG.

Free full text: Click here

Pogacar Z., Groot K., Jochems F., Dos Santos Dias M., Mulero-Sánchez A., Morris B., Roosen M., Wardak L., De Conti G., Velds A., Lieftink C., Thijssen B., Beijersbergen R.L., Bernards R, & Leite de Oliveira R. (2022). Genetic and compound screens uncover factors modulating cancer cell response to indisulam. Life Science Alliance, 5(9), e202101348.

Publication 2022

SANGER sequenced ISOLATE II PCR and Gel Kit Exo-Cip Rapid PCR Cleanup Kit

Primers

Corresponding Organization : The Netherlands Cancer Institute

Top 5 similar protocols

Variable analysis

independent variables

Gene editing technique (using different gRNAs)

dependent variables

Gene editing efficiency (analyzed using TIDE analysis software)

control variables

Cells containing the control gRNA (used to correct for background editing percentage)

controls

Positive control: Cells containing the control gRNA
Negative control: Not explicitly mentioned

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!