Antibody and Primer Reagents for Flow Cytometry

Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.

Free full text: Click here

Kang X., Cui C., Wang C., Wu G., Chen H., Lu Z., Chen X., Wang L., Huang J., Geng H., Zhao M., Chen Z., Müschen M., Wang H.Y, & Zhang C.C. (2018). CAMKs support development of acute myeloid leukemia. Journal of Hematology & Oncology, 11, 30.

Publication 2018

anti-Mac-1-APC anti-Gr-1-PE anti-CD3-APC anti-B220-PE anti-pCAMKII anti-CAMKI anti-CAMKII anti-CAMKIV anti-pCREB anti-CREB anti-actin STO-609 KN93

Actin Anti cd3 Antibodies Camki Camkii Flow cytometry Kn93 Mac 1 Primer Sto 609

Corresponding Organization : The University of Texas Southwestern Medical Center

Other organizations : University of Missouri Hospital, Dalian University, Dalian University of Technology, Missouri University of Science and Technology, University of California, San Francisco, First Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University, University of California, San Diego

Top 5 similar protocols

Variable analysis

independent variables

Anti-Kit-APC
Anti-Mac-1-APC
Anti-Gr-1-PE
Anti-CD3-APC
Anti-B220-PE
Anti-PirB-PE
PCAMKI
Anti-pCAMKII
Anti-pCAMKIV
Anti-CAMKI
Anti-CAMKII
Anti-CAMKIV
Anti-pCREB
Anti-CREB
Anti-actin
STO-609
HCAMKI forward primer
HCAMKI reverse primer
HCAMKIV forward primer
HCAMKIV reverse primer
PirB forward primer
PirB reverse primer
MCAMKIV forward primer
MCAMKIV reverse primer

dependent variables

Not explicitly mentioned

control variables

Not explicitly mentioned

controls

Positive controls: Not specified
Negative controls: Not specified

Annotations

Based on most similar protocols

Etiam vel ipsum. Morbi facilisis vestibulum nisl. Praesent cursus laoreet felis. Integer adipiscing pretium orci. Nulla facilisi. Quisque posuere bibendum purus. Nulla quam mauris, cursus eget, convallis ac, molestie non, enim. Aliquam congue. Quisque sagittis nonummy sapien. Proin molestie sem vitae urna. Maecenas lorem.

As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!