QKI-RAF1 dimerization mutants were generated by polymerase chain reaction-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAFR401H dimerization mutants35 (link), 36 (link) in QKI-RAF1 were generated using primers: forward CGCAAAACACACCATGTGAACA and reverse CAGAACAGCCACCTCATTCCT. QKIE48G dimerization mutants31 (link) in QKI-RAF1 were generated using primers: forward CTGGACGAAGGAATTAGCAGAG and reverse CAGCCGCTCGAGGTGGTT.
Molecular Cloning and Protein Detection
QKI-RAF1 dimerization mutants were generated by polymerase chain reaction-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAFR401H dimerization mutants35 (link), 36 (link) in QKI-RAF1 were generated using primers: forward CGCAAAACACACCATGTGAACA and reverse CAGAACAGCCACCTCATTCCT. QKIE48G dimerization mutants31 (link) in QKI-RAF1 were generated using primers: forward CTGGACGAAGGAATTAGCAGAG and reverse CAGCCGCTCGAGGTGGTT.
Partial Protocol Preview
This section provides a glimpse into the protocol.
The remaining content is hidden due to licensing restrictions, but the full text is available at the following link:
Access Free Full Text.
Corresponding Organization :
Other organizations : University of Pennsylvania, Children's Hospital of Philadelphia
Protocol cited in 1 other protocol
Variable analysis
SRGAP3-RAF1 constructsQKI-RAF1 constructs- Full-length
RAF1, QKI andSRGAP3 QKI-RAF1 dimerization mutantsRAFR401H dimerization mutants inQKI-RAF1 QKIE48G dimerization mutants inQKI-RAF1
- Protein expression and dimerization of the constructs
- Gateway-compatible N-MYC-tagged pMX-Puro Retroviral Vector
- Gateway destination vectors with either an N-terminal MYC or FLAG tag
- Anti-MYC antibody
- Anti-FLAG antibody
- Anti-CRAF antibody
- Positive control: Not explicitly mentioned.
- Negative control: Not explicitly mentioned.
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!