Molecular Cloning and Protein Detection

SRGAP3-RAF1 and QKI-RAF1 constructs were synthesized as Gateway-compatible entry clones. Full-length RAF1, QKI and SRGAP3 were purchased as gateway entry clones from PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core. Subcloning was carried out to integrate SRGAP3-RAF1, QKI-RAF1, full-length QKI, RAF1 and SRGAP3 into Gateway-compatible N-MYC-tagged pMX-Puro Retroviral Vector (Cell Biolabs, San Diego, CA, USA). NIH3T3 and early-passage PMAs were transduced using infection protocol previously described.^{18 (link)} Gateway destination vectors with either an N-terminal MYC or FLAG tag (Invitrogen, Waltham, MA, USA) were generated for all constructs. Anti-MYC antibody (Invitrogen R951-25, 1:5000) and anti-FLAG antibody (Sigma A8592, 1:10 000 from Sigma-Aldrich, St Louis, MO, USA) were used to detect tagged proteins along with anti-CRAF antibody (Cell Signaling #9422 from Cell Signaling Technology, Danvers, MA, USA).
QKI-RAF1 dimerization mutants were generated by polymerase chain reaction-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAF^R401H dimerization mutants^{35 (link), 36 (link)} in QKI-RAF1 were generated using primers: forward CGCAAAACACACCATGTGAACA and reverse CAGAACAGCCACCTCATTCCT. QKI^E48G dimerization mutants^{31 (link)} in QKI-RAF1 were generated using primers: forward CTGGACGAAGGAATTAGCAGAG and reverse CAGCCGCTCGAGGTGGTT.