To validate the RNA-seq results, six DEGs were selected and analyzed by qRT-PCR. The primer pairs were designed using Primer 5.0 (Supplementary Table S1 ). β-tubulin was selected as the internal reference gene (F: 5’ – CTTTCTTGCATTGGTACACGC – 3’; R: 5’ – TCGCCTTCTTCCTCATCGGCA – 3’).
Total RNA was isolated as described above. According to the manufacturer’s instructions, RNA was reverse-transcribed using a TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit (TransGen Biotech, Beijing, China). Then, 2 X RealAtar Green Fast Mixture with ROX (GenStar BioSolutions, Beijing, China) was used to perform qRT-PCR on the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Massachusetts, USA). The reaction system and conditions of qRT-PCR were conducted according to Fu et al. [29 (link)]. The relative expression of genes was determined using the 2− ΔΔCt method [114 (link)].
Total RNA was isolated as described above. According to the manufacturer’s instructions, RNA was reverse-transcribed using a TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit (TransGen Biotech, Beijing, China). Then, 2 X RealAtar Green Fast Mixture with ROX (GenStar BioSolutions, Beijing, China) was used to perform qRT-PCR on the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Massachusetts, USA). The reaction system and conditions of qRT-PCR were conducted according to Fu et al. [29 (link)]. The relative expression of genes was determined using the 2− ΔΔCt method [114 (link)].
Free full text: Click here
