GFP RNA Localization Assay

To assay RNA localization of GFP reporter constructs, complementary 18–20-nt DNA probes against the ORF of GFP (24 probes) were designed using the Biosearch Technologies Stellaris RNA FISH probe designer tool (https://biosearchtech.com). All probe sequences are provided in Supplementary Table 7. The reverse complement of the X FLAP^{44 (link)} sequence was added to the 5′ end of each probe: CCTCCTAAGTTTCGAGCTGGACTCAGTG. The X FLAP oligo (CACTGAGTCCAGCTCGAAACTTAGGAGG), 5′ and 3′ end-labeled with Quasar 570, was synthesized by Biosearch Technologies. X FLAP was hybridized with the probe set using the following conditions: 2 μl of the probe set (40 pmol in total), 0.5 μl of 100 μM X FLAP, 1 μl of 10× NEB 3 buffer and 6.5 μl of water were mixed and annealed in a thermal cycler as described previously^{44 (link)}: 85 °C for 3 minutes, 65 °C for 3 minutes, 25 °C for 5 minutes and 4 °C hold. Annealed probes were stored at −20 °C.