RNA was extracted from the hypothalamus (RNeasy® Lipid Tissue, Qiagen, Hilden, Germany). Quantitative polymerase chain reaction (RT-qPCR) was performed using exon–exon boundary-spanning primer sequences (see below) and the SYBR Green methodology on a Step One Plus sequence amplification system (Applied Biosystems, Foster City, CA, USA). The relative mRNA expression of the tested gene normalized to Gapdh expression was calculated using the ΔΔCt method.
The primers were as follows: Negr1 forward/reverse: ATGTGACGCAGGAGCACTT/CCATACTGGGCTGTACTTGGA [85 (link)]; Lsamp forward/reverse ATCACCAGGGAACAGTCAGG/TCCCGGTACCACTCAAAGTC [67 (link)]; Adam10 (QT00106351, Qiagen, Hilden, Germany).
The primers were as follows: Negr1 forward/reverse: ATGTGACGCAGGAGCACTT/CCATACTGGGCTGTACTTGGA [85 (link)]; Lsamp forward/reverse ATCACCAGGGAACAGTCAGG/TCCCGGTACCACTCAAAGTC [67 (link)]; Adam10 (QT00106351, Qiagen, Hilden, Germany).
Free full text: Click here
