The primers were as follows: Negr1 forward/reverse: ATGTGACGCAGGAGCACTT/CCATACTGGGCTGTACTTGGA [85 (link)]; Lsamp forward/reverse ATCACCAGGGAACAGTCAGG/TCCCGGTACCACTCAAAGTC [67 (link)]; Adam10 (QT00106351, Qiagen, Hilden, Germany).
Quantitative Gene Expression Analysis of Hypothalamic Samples
The primers were as follows: Negr1 forward/reverse: ATGTGACGCAGGAGCACTT/CCATACTGGGCTGTACTTGGA [85 (link)]; Lsamp forward/reverse ATCACCAGGGAACAGTCAGG/TCCCGGTACCACTCAAAGTC [67 (link)]; Adam10 (QT00106351, Qiagen, Hilden, Germany).
Corresponding Organization : Johannes Gutenberg University Mainz
Other organizations : Leibniz Institute for Resilience Research
Variable analysis
- None explicitly mentioned
- Relative mRNA expression of the tested genes (Negr1, Lsamp, Adam10) normalized to Gapdh expression
- Gapdh expression (used for normalization)
- Positive control: None specified
- Negative control: None specified
Annotations
Based on most similar protocols
As authors may omit details in methods from publication, our AI will look for missing critical information across the 5 most similar protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!