Overexpression and Silencing of ZFAS1 and AAK1

Full length of ZFAS1 or adaptor-associated kinase 1 (AAK1) sequence was synthesized by RiboBio (Guangzhou, China) and inserted into the pcDNA3.1 vector (V79020; Invitrogen, CA, USA) to generate pcDNA/ZFAS1 or pcDNA/AAK1. The miR-4711-5p mimics (UGCAUCAGGCCAGAAGACAUGAG), control miRNA mimics (NC mimics; AAACACUUCAAGAGGGGUCCAUA), as well as shRNA targeting ZFAS1 (sh-ZFAS1; GAATATATATATACATATA) and scrambled control (sh-NC; TATATGTATATATATATTC) were obtained from RiboBio (Guangzhou, China). NP cells were seeded into 24-well plates at 1 × 10⁷ cells/well, and then 2 µg vectors or 50 nM synthetic oligonucleotides were transfected into NP cells. Transfection was performed by using Lipofectamine 2000 (11668; Invitrogen) according to the manufacturer’s protocol [19 (link),20 (link)].